Starvation Experiment

Background

Hydrogen sulphide is critical to the lucinid symbiosis because the endosymbionts use it as an energy source to fix the carbon in order to provide for the host’s nutritional requirements. Rearing clams in starvation conditions (i.e. sulphide-free aquaria) for an extended duration leads to the gradual degradation and loss of endosymbionts in the bacteriocytes. Furthermore, the inability of endosymbionts to provide for their host nutritionally could signal a change in the status of the symbiotic relationship to the host. However, the molecular mechanisms regulating the loss and degradation of symbiont bacteria under these conditions are not known. We hypothesise that the loss of symbionts under sulphide deprivation is regulated by interactions between metabolic and immune processes in the host. To test this hypothesis, this project has been organised into three parallel approaches: (1) Symbiont abundance assay, (2) Microscopy of the gills, and (3) Dual RNA-Seq to investigate the transcriptional changes and cellular responses associated with the gradual reduction in endosymbiont abundance during sulphide deprivation. This study aims to provide important insights into the molecular and cellular mechanisms the host uses to control symbiont abundance.

Clam collection

Clam metadata

• Species - Loripes orbiculatus
• Collection date: 17 July 2018
• Collection location: Bay of Fetovaia Elba
• Collection coordinates: 42.7345214,10.1529408
• Collection method: diving, digging

Loripes orbiculatus specimens were collected in the Fetovaia Bay, Elba island, Italy (N 42°43‘49.0 E 10°09‘20.5) in July 2018. The collection site was at 7 m depth and in the proximity of a Posidonia oceanica seagrass meadow. The clams were collected by digging up and sieving of the sediment. A subset of ten collected clams was immediately dissected and one gill ctenidium was fixed in 4% paraformaldehyde (PFA) for FISH (Suppl. protocol 2), the other gill and the rest of the body were fixed in RNAlater™(Thermo Fischer Scientific) according to the manufacturer’s instructions and stored at -20°C.

Experimental Conditions

Aquarium parameters

• Salinity: 38ppt
• Temperature: 22-24 degrees
• Volume: 50L unfiltered seawater from Elba
• No water changes were performed throughout the experiment

Microcosm descriptions

• 18 microcosms, each individually aerated
• Plastic jars 500ml
• N=4 clams per jar
• Sediment originated from the luci Posidonia patch (same location where clams were collected). Filled to a of depth 5.5cm (roughly 320 cubic centimetres)
• Conditions: ⋅⋅* N=9 jars Sulphidic: ⋅⋅⋅ Seagrass debris stuff in coffee filters lining base of container and then covered with sand ⋅⋅* N=9 jars Washed sediment: ⋅⋅⋅ Sand washed 4-5 times with unfiltered seawater to remove sulphides and organic material

Experimental design:

• All clams were dissected and sampled as follows: 1 gill fixed in 4% PFA-MOPS and all remaining tissue preserved in RNALater.
• Fresh clams were sampled on 17 July 2018 immediately after collection.
• The remaining fresh clams were brought back to Vienna and placed in either a organic matter-supplemented microcosm or a washed sediment microcosm (n=5 per container).
• Clams were sampled at three time points after this: T+2 weeks (1 Aug 2018), T+6 weeks (1 Sept 2018), and T+10 weeks post from T0 (27 Sept 2018).
  • All time points were used for symbiont abundance assays
  • FISH and RNA-Seq were carried out only on samples from the final time point, T+10W (2month)

Experiment log:

1 Aug 2018 (T+2 weeks):

Clams from both treatments had dark gills and the overwhelming majority of were heavy with gametes. It's reproductive season and the clams are using much more energy for gamete production. They could be relying more heavily on symbionts for nutrition - digestion or nutrient transfer (not mutually exclusive). Sediment from sulphide treatment was a little darker but this doesn't necessarily indicate presence of sulphide that the clams can use. Clams from T+2 week treatment were dug up and I fixed one ctenidium in 4% PFA-MOPS (1mL) and preserved the remainder of the clam (including all organs and shells) in RNAlater (3mL).

17 Aug 2018:

Sediment from sulphide treatment was still a little darker but did not smell as strongly of sulphide as it did when the sediment was first placed in the containers. I checked clams from sulphide treatment jar and they had dark gills. This suggests there was not enough sulphide build up in the sediment, perhaps because it takes time for the community to establish. Stirred up sediment in washed treatments to aerate and reduce sulphide availability. Added more a tablespoon of extra seagrass debris to the sulphide treatment jars and delay sampling

1 Sept 2018 (T+6 weeks):

Sulphide treatments microcosms were consistently darker than the washed sediment microcosms. The washed sediment microcosms were not as light as expected compared to some of the other tubs of non-experimental clams. Clams were in good condition and all alive. Most clams did not have gametes (maybe 5 out 24 - double check in pictures). When gametes were found, only sperm was observed, never eggs. This probably indicates the end of the reproductive season. The sulphide supplemented clam gills were mostly quite pale, dense and opaque with one or two exceptions. The washed sediment clams had generally pale gills too but these gills were not as dense as sulphide clams. This observation is based on the opacity of the gills under light and observations of thickness. Every pairwise comparison indicated that more light penetrated the washed sediment clams.

27 Sept 2018 (T+10 weeks)

Similar observations to previous time point. Clams in sulphide supplemented treatments had paler denser gills than sulphide-deprived clams. Porewater from 2month sulphide treatment was highly sulphidic. Visible precipitation immediately once the water came in contact with the zinc acetate. Too much sulphide in S22M container and all clams except one in this treatment were recently deceased as suggested by the presence of decomposing tissue.

Sample codes

ID codes for each experimental replicate and biological replicates:

• TreatmentRep#_Timepoint_BiologicalRep#
  • Example: W#_2W_1 or S#_1M_4. Where W - washed, S - sulphide, 2W - 2 weeks, 1M - 1 month

Pore water collection

Pore water extracted using rhizons. Only 2cm of rhizon was left exposed for extraction, the remainder of the pore segment was parafilmed to prevent surface water contamination. Flushing rhizons - rapidly clogged, extraction is very very slow. Took a total of two hours to obtain 3 sub-samples from each treatment replicate

1. Flush by sucking up MQ and releasing MQ.
2. Removed all MQ from rhizon by sucking until only air comes out
3. Before next use, insert rhizon into sediment, suck up pore water with flushing syringe until air reaches the rhizon tube/syringe interface.
4. Replace flushing syringe with syringe containing 1ml 4% zince acetate Note: Was not able to withdraw much more than 1 ml of pore water from first sub-sample attempt. Subsequent samples were even harder, volume of water extracted for all subsequent samples was 0.5ml (adjusted zinc acetate volume t0 0.5ml)

Wet lab protocols

Nucleic acid extraction

DNA and total RNA were extracted from the gills using the TRIzol™ (Thermo Fischer Scientific) extraction protocol with the following modifications. Manual tissue homogenisation carried out using tissue grinders and glass beads. Bromochloropropane (BCP) was used for phase separation and DNA was extracted using the back extraction buffer (4 M guanidine thiocyanate, 50 mM sodium citrate and 1 M Tris). The extracted DNA and RNA were quantified with the Qubit 4 Fluorometer (Thermo Fischer Scientific) using a Qubit dsDNA BR Assay Kit (Thermo Fischer Scientific) and Qubit RNA BR Assay Kit, respectively. Total RNA was treated with DNAse using the Turbo DNAse kit.

Tissue embedding and Fluorescence in situ Hybridisation

Based on the data from qPCR assays, six samples were chosen for microscopic analysis of changes in symbiont abundance. Three PFA fixed gills from individuals of each treatment group at the T+10 weeks time point were embedding in paraffin at the Histopathology facility in Vienna BioCenter Core Facilities GmbH. The embedded samples were cut using a Leica RM2235 microtome. Five and seven µm thick samples were placed on SuperFrost Ultra Plus™ Adhesion Slides (Thermo Fischer Scientific) and further dewaxed using Roti®-Histol according to the manufacturer’s protocol. FISH was performed using probes targeting Eukaryota, Gammaproteobacteria, Ca. Thiodiazotropha endoloripes as well as a non-binding probe. The hybridizations on gill sections separated with Pap-Pen were performed using 35% formamide for three hours at 46°C. After the hybridization, the slides were incubated in washing buffer for 15 min at 48°C followed by quick rinse in ice-cold MilliQ. The sections were additionally stained with DAPI (1 g/ml) and mounted in CitiFluor™. The visualisation was done using CLSM Leica TCS SP8X with Leica CTR 6500 laser and LASX Software.

Probe name	Specificity	Sequence (5’- 3’)	Conjugated dye
EUK516	Eukarya	ACC AGA CTT GCC CTC C	Fluos
Gam42a	Gammaproteobacteria	GCC TTC CCA CAT CGT TT	Cy5
845	Ca. Thiodiazotropha endoloripes	TTA GCT GCG CCA CTA AAC CCT	Cy3
Non-338	Negative control	ACT CCT ACG GGA GGC AGC	Cy3

ddPCR symbiont specific primers

Target	ID	Primer sequence 5'-3'	Start	End	Oligo size	Direction	Amplicon size	TM
Urease gamma subunit (UreA)	UREA37F1	CTGTTTACGGCGGGACTGCT	37	56	20	forward	279	62.8
Urease gamma subunit (UreA)	UREA315R1	GTCACGCTCGGTGGGTAGAA	296	315	20	reverse	279	61.9
Nitrite reductase (NirS)	NIRS19F1	CCAAGCGTGAGGACCGGTAT	19	38	20	forward	385	62
Nitrite reductase (NirS)	NIRS403R1	GGCGCTCTTTCATCAAGGCC	384	403	20	reverse	385	62

Sequencing info

• Total RNA underwent rRNA depletion using the riboZero kit.
• Library prep was carried out using the NEB kit
• Libraries were sequenced through the JMF at the BSF on the HiSeq 4000 to generate approximately 35 million 2x100bp reads per library

All raw files, important intermediate and final output files are located in this project folder /lisc/project/dome/Marine_Symbiosis/BY04_LoripesStarvationExp Active work is be done here: /lisc/scratch/dome/yuen/BY04_LoripesStarvationExp/

Sample details

SampleID	BSF sample ID	JMF sample ID	User sample ID	Sample description	Experiment_sample_ID	BSF_code	Lane	Size	LucA_alignment % overall alignment rate	LucE_alignment % overall alignment rate	non_rRNA_reads
0001_S56887	S56887	JMF-1905-3-0001	1A	Freshly collected	F1	86423	3	19032942412	20.98	17.06	Total reads failing E-value threshold = 54050707 (69.16%)
0002_S56885	S56885	JMF-1905-3-0002	1B	Freshly collected	F2	86424	3	17222152450	19.55	22.17	Total reads failing E-value threshold = 31195285 (44.11%)
0003_S56882	S56882	JMF-1905-3-0003	1C	Freshly collected	F3	86425	2	21723622182	23.2	19.19	Total reads failing E-value threshold = 52619809 (58.99%)
0005_S56880	S56880	JMF-1905-3-0005	1E	Freshly collected	F6	86427	2	11524604826	20.91	24.88	Total reads failing E-value threshold = 24890873 (52.60%)
0006_S56881	S56881	JMF-1905-3-0006	1F	Freshly collected	F7	86428	2	34505383312	28.65	23.33	Total reads failing E-value threshold = 70958397 (50.08%)
0007_S56878	S56878	JMF-1905-3-0007	1G	Sulphidic sediment	S12M1	86429	2	11365303076	10.02	9.41	Total reads failing E-value threshold = 45258868 (96.97%)
0008_S56886	S56886	JMF-1905-3-0008	1H	Sulphidic sediment	S12M3	86430	3	13072491026	5.1	5.32	Total reads failing E-value threshold = 34690286 (64.62%)
0009_S56879	S56879	JMF-1905-3-0009	2A	Sulphidic sediment	S12M4	86431	2	9255825914	10.96	9.42	Total reads failing E-value threshold = 34191756 (89.96%)
0010_S56876	S56876	JMF-1905-3-0010	2B	Sulphidic sediment	S32M3	86432	2	8666977788	7.3	7.02	Total reads failing E-value threshold = 33705050 (94.70%)
0011_S56877	S56877	JMF-1905-3-0011	2C	Sulphidic sediment	S32M4	86433	2	20702722224	7.64	7.37	Total reads failing E-value threshold = 65225355 (76.72%)
0012_S56883	S56883	JMF-1905-3-0012	2D	Washed sediment	W12M3	86434	3	8402740832	3.92	3.61	Total reads failing E-value threshold = 31467771 (91.20%)
0013_S56884	S56884	JMF-1905-3-0013	2E	Washed sediment	W22M2	86435	3	14496283058	4.44	5.23	Total reads failing E-value threshold = 42513638 (71.42%)
0014_S56889	S56889	JMF-1905-3-0014	2F	Washed sediment	W22M3	86436	3	22965038638	0.39	0.64	Total reads failing E-value threshold = 73256630 (77.68%)
0015_S56888	S56888	JMF-1905-3-0015	2G	Washed sediment	W22M4	86437	3	11698429090	1.99	2.25	Total reads failing E-value threshold = 35841155 (74.61%)
0016_S56890	S56890	JMF-1905-3-0016	2H	Washed sediment	W32M3	86438	3	10395674794	6.89	6.15	Total reads failing E-value threshold = 41046574 (96.15%)
0017_S56875	S56875	JMF-1905-3-0017	3A	Washed sediment	W32M4	86439	2	7739725378	5.21	4.62	Total reads failing E-value threshold = 25420112 (79.98%)

Bioinformatics workflow

1. 1_bamtofastq_1.sh #convert raw reads to fastq files
2. 1_fastqc_1.sh #check quality of fastq files
3. 2_rcorrector_1.sh #read correction
4. 2_FilterUncorrectabledPEfastq.sh #filter out uncorrectable reads
5. 3_sortmerna #remove rRNA reads
   • 3_sortmerna_merge_1.sh
   • 3_sortmerna2.1_search_1.sh
   • 3_sortmerna_split.sh
6. 4_trimmomatic_t20_1.sh #remove adaptors and quality trimming
7. 5_bt2map_symbremove_2.sh #map reads to combined LucA (Ca. T. weberae) and E (Ca. T. lotti) genomes to remove symbiont reads for host differential expression experiment
8. 6_convert_bam_to_fastq #extract unmapped reads
9. 7_salmonquant_loop_3.sh #map host reads to reference transcriptome
10. 8_symbiont_read_mapping #map reads to individual symbiont genomes
    • bbmap_lucA.sh
    • bbmap_lucE.sh